Data in Hiding

When Viviana Risca was a high school student in Port Washington, New York, she found a way to hide secret messages among DNA molecules. Heaps of DNA strands sit like microscopic spaghetti inside plant and animal cells. They are a kind of secret code already, only the secret message they normally carry is instructions for making a living creature, such as a clam or a peacock.

How did Risca use DNA to send a message? DNA is a big molecule that looks like a twisted ladder. The rungs on the ladder are chemical units called bases. Working with researchers at the Mount Sinai School of Medicine in New York City, Risca created a single strand of DNA made up of a sequence of bases corresponding to the letters of a message. She mixed this message strand with many other, different DNA molecules.

The researchers then dripped a tiny amount of the DNA onto a small dot printed on filter paper. They cut out the dot, taped it over the period in a typed note, and mailed the letter.

The person who got the secret message had to know three things to decode it. He had to know that one of the periods in the letter was a phony. He had to know a special marker DNA sequence that would allow him to chemically pick the message strand out from all the other DNA strands. And he had to know which series of bases corresponded to which letters of the alphabet.

The letter's recipient lifted the DNA dot, ran it through some chemical steps that picked out the right DNA strand and read out its sequence of bases, and decoded the message using Risca's key. Risca won the top prize in the 2000 Intel Science Talent Search for this project.

When spies of the future want to pass secret messages to one another, maybe they'll bone up on molecular biology.

Decoding a DNA Message

The information in a DNA molecule is in the rungs of this ladderlike molecule. These are chemical units called bases, and there are only four of them: adenine, thymine, guanine, and cytosine—abbreviated A, T, G, and C. Normally, sets of three bases specify part of a protein, the molecules that do most of the work in a living creature. In Risca's code, however, sets of three bases stood for letters of the alphabet. For example, she made the letter L by adding the bases TGC to the message strand she was building.

Key to Risca's Code:


Try decoding Risca's secret message:

AGTCTGTCTGGCTTAATAATGTCTCCTCGAACGATGGGATCTGCTTC
TGGATCATCCCGATCTTTGAAA.

---

Muse, January 2001, p. 22.